Table S15  List of mouse probes used for in situ hybridization
This chart shows the Unigene number and identity of the newly characterized confirmed photoreceptor-enriched transcripts and the accession number of the EST used as an in situ probe.  Entries listing
PCR represent probes generated by PCR.  The PCR primers and product size representing these Unigene clusters that were obtained by PCR are shown below the list of EST probes.
Gene Mouse probe
10085 nuclear factor of activated T-cells, cytoplasmic 1 BE633324
100975 ESTs BF551899
101118 Ras negative regulator Rabex-5/Rin2 BE305992
101476 ESTs/40838 Na-dependent inorganic phosphate cotransporter/VGLUT-1 AI851913
101833 ESTs/galectin 8 AW211925
102470 ESTs BF470003
102679 ESTs BF522350
10301 phosphatidylinositol 3-kinase, C2 domain containing, gamma polypeptide AA967810
103712 ESTs/protein of unknown function PCR
10780 similar to oligosacharyltransferase STT3 subunit BE647490
111887 ESTs/protein of unknown function BE457506
116683 ESTs/A20? BE849027
11678 ESTs AA437956
117008 ZNF262 BF022967
117022 AF180470/novel glycosyltransferase BF719112
12019 ESTs/Na-K ATPase beta 2 subunit AI845260
12055 inositol polyphosphate multikinase BG147431
122067 ESTs PCR
122087 ESTs BF449937
125811 ESTs PCR
128183 KIAA0863/homeodomain transcription factor BF158746
12914 Mus musculus ubiquitin-specific protease UBP41 (Ubp41) AI846522
130902 ESTs/152519 proline-rich protein AA616812
131592 ESTs BE686333
131653 musashi-1 PCR
131710 ESTs BF465573
133032 ESTs AI662834
133521 ESTs/zinc finger homeodomain 4 BF147593
133603 ESTs/protocadherin gamma C4 PCR
133635 ESTs PCR
133687 ESTs/similar to OATP-E AA473599
133990 ESTs/nuclear protein BE647993
134304 ESTs PCR
136988 ESTs/novel K channel? BF523810
138316 ESTs PCR
138550 ESTs PCR
139204 ESTs/MHC E-beta 2 BF662424
140496 Fanconi anemia complementation group E homolog BE285331
14099 hematopoetic zinc finger AI415698
143811 Mus musculus BETA3 mRNA, complete cds BB394098
143816 poly(rC)-binding protein 3 AW048741
150221 EST PCR
150542 ESTs BE949265
150554 EST BF470793
151012 ESTs AW125320
151536 ESTs PCR
152323 ESTs/DRIM BF472544
152952 ESTs BE985995
1532 ESTs/PP1665 AI112541
153891 ESTs/protein phosphatase 4a3 BG276478
153895 ESTs BE633094
154489 ESTs, Moderately similar to AF094609_1 fertility related protein WMP1 [R.norvegicus] BE369401
1640 cerebellar degeneration-related 2 AA673164
1693 high mobility group box 2 AW046897
17613 ESTs/probable SNK/polo-like kinase AW048815
17804 ESTs/mCTR2 BE851825
182462 ESTs AW533667
183018 ESTs  AI851309
1843 heat shock 90kD protein 1, alpha AI839932
18499 ESTs BF662402
18516 H3 histone, family 3B AI841334
18522 carnitine palmitoyltransferase 1, liver AI846647
186013 EST PCR
19077 ESTs/KIAA1351 rac GTPase related AI550313
1915 ESTs AI843358
1921 ESTs, Moderately similar to KIAA0826 protein [H.sapiens] AI836821
193093 PKAbeta AW496459
196081 novel cylophilin/high retinal expression AW122135
2003 mdm-1 nuclear protein AW321423
200894 ESTs/KIAA0306 (cytoskeletal) AI850859
2032 interferon dependent positive acting transcription factor 3 gamma BF660863
20872 like-glycosyltransferase AI838557
21383 ESTs/CGI-145 AI841275
21389 type II deiodinase AI852512
21470 ESTs/similar to UDP-galactose transporter-related protein AI842275
21761 ESTs, Moderately similar to A56391 lamina associated polypeptide 1C long splice form - rat [R.norvegicus] AI853475
22085 Mus musculus ADP-ribosylation factor-like protein 3 (Arl3) mRNA, complete cds AI892178
22314 ATP-binding cassette, sub-family A (ABC1), member 3 AA717342
22358 ESTs, Weakly similar to TFSL_MOUSE TRANSCRIPTION FACTOR S-II-RELATED PROTEIN 3 [M.musculus] AI846500
2240 similar to succinate dehydrogenase flavoprotein AW323348
22440 TRAP150 AI836625
22682 ESTs, Moderately  similar to PHOSPHATIDYLINOSITOL-4-PHOSPHATE 5-KINASE TYPE II [Homo sapiens] AI851871
22758 ESTs/potential steriod isomerase AI852782
23195 ESTs, Weakly similar to KIAA0377 [H.sapiens] AI450926
23494 ESTs/KIAA0931 BE303825
23739 XAB2/HCNP AI851650
23843 ESTs/novel lectin binding protein AI842077
2389 myeloid/lymphoid or mixed-lineage leukemia AA118875
2395 male enhanced antigen 1 AI414814
23971 dsRNA adenosine deaminase AI842795
2400 glutathione peroxidase 4 AI850040
24009 ESTs BE633326
24014 ESTs/similar to KIAA1052 AI450905
24117 ESTs, Moderately similar to unnamed protein product [H.sapiens] BE309729
24149 ESTs/contains G beta repeats BG092839
24300 leucine zipper transcription factor AI666705
24309 ESTs/harmartin (tuberous sclerosis 1) AI837319
24430 unc5 homolog (C. elegans) 3 AA387900
24514 ESTs/rheb2 AW048908
24594 mitochondrial uncoupling protein 1 AI852122
25298 signal transducer and activator of transcription 3 interacting protein 1 AI849238
25695 ESTs/bicaudal C (RNA bp) AI852358
25715 KIAA0853 AW492537
26579 ESTs AW495527
2672 mannoside acetylglucosaminyltransferase 1 AI840067
26828 ESTs/erb2-interacting protein ERBIN AI843677
27013 ESTs/voltage-dependent calcium channel beta-2c AW060387
27029 ESTs AI552778
27033 DNA segment, Chr 15, ERATO Doi 81, expressed AI847650
27057 ESTs AI007199
27232 ESTs/novel Zn finger protein BE852251
27256 discs large homolog 4 AI450221
27325 ESTs AI838908
27359 ESTs/nephronopthisis protein BE649996
27359 monocarboxylate transporter 6 BE848456
27496 ubiquitin specific protease 1 AI848382
27583 ESTs, Weakly similar to ZK1058.5 [C.elegans]/methyltransferase AW519571
27673 ESTs/osteoblast protein/novel glycosyltransferase AI841826
27698 ESTs/KIAA0140 homolog (putative nuclear protein) AI467602
27728 ESTs AI845850
27802 thymic dendritic cell derived factor AI846235
28005 BBS2 AI851478
28147 ESTs, Moderately  similar to POLYPOSIS LOCUS PROTEIN 1 [Homo sapiens] AA914367
28209 Mus musculus p53 apoptosis-associated target (Perp) mRNA/tetraspanin AI854029
28405 serum/glucocorticoid regulated kinase/hypertonicity activated AI854349
28482 novel metalloprotease AI836224
28526 ESTs /KIAA0321 FYVE Zn fingers+weak similarity to hrs-2 AA967609
28542 ESTs, Weakly similar to similar to S. cerevisiae hypothetical protein YKL166 [C.elegans] AI852060
28654 ESTs, Weakly similar to CG8195 gene product [D.melanogaster] BE308346
28896 phosphatidylcholine transfer protein-like AI849800
28914 ESTs AI430543
29001 ESTs, Highly  similar to URACIL PHOSPHORIBOSYLTRANSFERASE [Saccharomyces cerevisiae] AI851238
29055 chromobox HP1 BE851851
29308 protein L-isoaspartate-O-methyltransferase homolog BE447981
29356 ESTs/isoprenylcyteine carboxylmethyltransferase AW494010
29385 protein phosphatase 1, regulatory subunit 10 AW488180
29477 peroxisome proliferative activated receptor, gamma, coactivator 2 BE852933
29579 ESTs AI836856
29730 four jointed box 1 AI465262
29762 taurine/beta-alanine transporter AI326802
29794 Y box bp 3 AI843687
29912 ESTs, Moderately similar to molybdopterin synthase sulfurylase [H.sapiens] AI839519
30007 Mus musculus muscleblind mRNA, complete cds AI854176
30038 erythrocyte protein band 4.1 AI840295
30058 amino acid transporter protein NAT-1/histidine+glutamine AI839742
30069 Tax1BP/interacts with A20 AI843287
30200 ESTs, Highly  similar to ELECTRON TRANSFER FLAVOPROTEIN BETA-SUBUNIT [Paracoccus denitrificans] AI848359
30556 ESTs AI463445
30688 ESTs/CMV fusion receptor AI450970
30829 ESTs/cyclin D-binding myb-like transcription factor AI448589
30870 ESTs AI481947
30911 ESTs AI552264
30935 ESTs, Highly similar to tudor repeat associator with PCTAIRE 2 [R.norvegicus]  AI447470
31161 ESTs AI480988
31170 cyclin K -- Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4 AI463252
31514 ESTs, Moderately similar to cell growth regulator rCGR19 [R.norvegicus] AI462472
32382 Interferon regulatory factor 6 BE691484
32416 ESTs/novel glycosyltransferase AI451145
33118 ESTs/novel rdgB2 homolog AI848332
33583 single-strand selective uracil gycosylase (SMUG1) AW050366
33875 torsin family 2, member A AI843178
33915 ESTs AI613936
33944 ESTs/splicing? BE291765
340 high-mobility group protein 4 AI853499
34125 ESTs AW519622
34200 Syntaxin 3A BF318336
34308 ESTs AI837275
34326 ESTs/Zn finger AI845904
34704 interleukin 15 receptor, alpha chain BE627836
34855 ESTs BE686752
34885 ESTs/Abeta crystallin-related/small HSP-like AI852989
35016 histocompatibility 2, T region locus 23 BF021004
35060 ESTs/novel IAP AI020489
35108 ESTs/similar to D. unkempt zinc finger protein AI853158
35159 ESTs AI853191
35848 male germ-cell associated kinase AW495430
36292 ESTs/ubiquitin hydrolyzing enzyme 1 BE200409
36545 ESTs/esterase 10 AI839908
3667 vitronectin AI854511
36894 transcription factor 12/HTF4 AI850155
37607 ESTs AI846073
38058 ESTs AI840103
38381 ESTs, Weakly similar to DHBK_MOUSE PUTATIVE STEROID DEHYDROGENASE KIK-I [Mmusculus] AW124838
38763 ESTs/IMP dehydrogenase 1 AI848836
3879 hypoxia inducible factor 1, alpha subunit BE955791
38890 ESTs/Daxx AI842442
38993 ESTs/calsyntenin 1 AI837092
39097 ESTs AI851319
39513 ESTs/KCNMA1 calcium-activated potassium channel AI835710
39855 ESTs/novel sialyltransferase AI846736
39888 ESTs/KIAA0735 SV2B AW045524
40297 ESTs/Kv2.1 potassium channel AI852064
4063 N-myc downstream regulated 1 AI852317
40727 ESTs/novel cadherin AI852446
40852 ESTs AI847159
41269 ESTs/lysophosphatidic acid acyltransferase-gamma1 AI839508
41271 ESTs/similar to phosphotidylcholine transfer protein AI852671
41350 ESTs/TED homolog/CAG repeat AI835545
41406 ESTs, Highly similar to KIAA0913 protein [H.sapiens] AI853865
41489 protein of unknown function BF472300
41649 ESTs/KIAA0515 ubiquitin-like motif? AI853997
41702 Sox11 AI835269
41744 ESTs/KIAA0795 AI849443
41776 otoconin 90/phospholipase A2-like AI894211
41860 ESTs, Weakly similar to collagen type XIV [M.musculus] AI838662
41877 ESTs, Weakly similar to mCAC [M.musculus] AI853021
43603 carboxypeptidase E BE686085
43731 KIAA1134 BF160911
43737 M.musculus mRNA for casein kinase I-alpha AI847674
44123 Similar to hypothetical protein FLJ20186/DAG binding motif/4 LZ/TNFR C-rich motif AI847127
44702 ESTs AW050046
4471 ESTs/v. weak similarity to prominin? AI838217
44868 ESTs/novel protein kinase AW047494
45160 ESTs AW049253
45192 ESTs/KCNE2 minK-type K-channel MiRP1 AW048273
45194 ESTs, Moderately similar to unnamed protein product [H.sapiens] BE686297
45237 ESTs, Highly similar to atypical PKC specific binding protein [Rnorvegicus] BE988459
45390 ESTs  BF522350
45565 ESTs/Dyrk2 AI764532
45994 tetraspan 1 AI643349
46019 ESTs AI842852
46489 ESTs/chondroitin 4-sulfotransferase paralog AW742878
46606 ESTs, Moderately similar to SECIS binding protein 2 [R.norvegicus] AI837465
46628 vascular endothelial zinc finger 1 AI642684
46764 phosphitidate cytidyltransferase AI413216
46776 ESTs BG148691
46786 tctex-1 BE630930
47052 similar to testis lipid binding protein BE982430
4881 granin-like neuroendocrine peptide precursor AI848336
5185 ESTs PCR
54359 Mus musculus APRIL mRNA, complete cds BE631332
54993 novel PI PDE BF168813
56990 excision repair 2 BE691611
57052 GTP-rho binding protein 1 AW210837
5856 Mus musculus BS4 peptide mRNA, complete cds AI844804
63232 ESTs/PR domain containing 8 AI414839
6667 single-strand DNA binding protein 3 AI854882
68134 ESTs AW494810
68170 Kir2.4 BF543309
69023 ESTs, Weakly similar to KIAA1537 protein [H.sapi/FYVE Zn finger AA754980
69049 Mus musculus hypothetical protein mRNA, partial cds/similar to RAD4 AI854095
695 abl-interactor 1 AI840745
70121 ESTs/novel CaBP BE119125
71015 protein disulfide isomerase related protein BE456289
732 dolichyl-phosphate mannosyltransferase polypeptide 3 BF470038
7331 pre B-cell leukemia transcription factor 3 AI415655
74737 ESTs/SOD3 AW060724
7919 hrs-2 Zn finger SNAP-25 interacting ATPase  AI844038
80063 ESTs BE106620
80685 microfibril associated glycoprotein AI430252
814 DNA segment, Chr 10, ERATO Doi 398, expressed/4.1G AI845287
81416 novel retinol dehydrogenase/CGI-82 AA821382
8180 Ly6C BF453976
86457 ESTs/novel protein kinase BF179218
87450 oxysterol binding protein BE647854
87653 ESTs/novel Zn finger AA024316
89136 H3 histone, family 3A AW260090
89584 inositol hexakisphosphate kinase 2 BF163467
9001 nemo like kinase AI849001
90048 estrogen related receptor beta 2 AA589656
90390 ESTs/novel PI kinase AW495463
9086 solute carrier family 16 (monocarboxylic acid transporters), member 1 AI854532
911 high mobility group protein 17 AI836705
95741 ESTs/Zn finger transcription factor AW825066
9838 ESTs AI840910
PCR primers used to obtain probes
Gene 5'primer used 3'primer used Product size
133635 ESTs GCGCGGCCGCGTGGTCCTGGGTTTTATTAT GGGATCCGAAGTTATCAGAAGGGAAGAA 297
134304 ESTs GCGCGGCCGCCTTTTTCTAGATGCAGAGACTTTA GGGATCCAGGTTTAATTCTTTTTCCTTGAA 305
138316 ESTs GCGCGGCCGCACCTTGACACATGTTATCTACCAGCA     GGGATCCCATGCAGGTATTAGTGTGGGTTTAGAC    384
151536 ESTs GCGCGGCCGCAATGGGAATTTTGAAGAAGTACAGCC     GGGATCCTTTAAGGGCACAAAGGATACCTTAAGA    348
152952 ESTs GCGCGGCCGCGCTTTCCCTTGCTTTAGGACGA         GGGATCCCACCAGGTCCCAAGTCCCTAA          405
5185 ESTs GCGCGGCCGCTAAATCTCGCTCAGGATGTAGGTCC      GGGATCCTTGGGTCCTGGACCAAGACAT          260
138550 ESTs GCGCGGCCGCTTATGGCAATGTAACAGATGCCG GGGATCCGAGTCCATGTTTCTCAAAAACACCA 258
150221 EST GCGCGGCCGCTTTTTTCAGTACCTGGGAATTAACCC GGGATCCAACATGCTGTAGGAAGCCCGT 392
131653 musashi-1 GCGCGGCCGCGCACCGAGGAGCCAATG GGGATCCGTGTTCTTTAAAGAGGTGGGTAAC 283
125811 ESTs GCGCGGCCGCCGGCTCGGAGTTACAGATGGT GGGATCCAGATGGGCCGGGTCACTTAC 251
186013 EST GCGCGGCCGCGAGACCTTATCCCTTCACAC GGGATCCTTATCACATTATCGCAAACAT 294
133603 ESTs/protocadherin gamma C4 GCGCGGCCGCACACCAGACAACATGAGACAAAAG GGGATCCGCTCAACCCTATAGATCAGAACTC 338
103712 ESTs/protein of unknown function GCGCGGCCGCGCGGCTGCAGTTGGAGGATGTATG GGGATCCTATGTGGGCCTTGTGTCTGTGTCA 609
47052 similar to testis lipid binding protein GCGCGGCCGCCCTACTTGGGAGTTTTATTCGAACAAC GGGATCCCAAAAGCAGGGGTACAGTGATCTTAG 257